A carregar...
The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.
The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...
Na minha lista:
| Main Authors: | , , , , , , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
1981
|
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC326725/ https://ncbi.nlm.nih.gov/pubmed/7232209 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|