The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...

Full description

Saved in:
Bibliographic Details
Main Authors: Luehrsen, K R, Fox, G E, Kilpatrick, M W, Walker, R T, Domdey, H, Krupp, G, Gross, H J
Format: Artigo
Language:Inglês
Published: 1981
Online Access:https://ncbi.nlm.nih.gov/pmc/articles/PMC326725/
https://ncbi.nlm.nih.gov/pubmed/7232209
Tags: Add Tag
No Tags, Be the first to tag this record!

Similar Items