QR Kod

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...

Ful tanımlama

Kaydedildi:
Yayımlandı:Nucleic Acids Res
Asıl Yazarlar: Luehrsen, K R, Fox, G E, Kilpatrick, M W, Walker, R T, Domdey, H, Krupp, G, Gross, H J
Materyal Türü: Artigo
Dil:Inglês
Baskı/Yayın Bilgisi: Oxford University Press 1981
Online Erişim:https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC326725/
https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7232209/
https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.4.965
Etiketler: Etiketle
Etiket eklenmemiş, İlk siz ekleyin!

Benzer Materyaller