A carregar...

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...

ver descrição completa

Na minha lista:
Detalhes bibliográficos
Main Authors: Luehrsen, K R, Fox, G E, Kilpatrick, M W, Walker, R T, Domdey, H, Krupp, G, Gross, H J
Formato: Artigo
Idioma:Inglês
Publicado em: 1981
Acesso em linha:https://ncbi.nlm.nih.gov/pmc/articles/PMC326725/
https://ncbi.nlm.nih.gov/pubmed/7232209
Tags: Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!