The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...

Ausführliche Beschreibung

Bibliografische Detailangaben

Veröffentlicht in:	Nucleic Acids Res
Hauptverfasser:	Luehrsen, K R, Fox, G E, Kilpatrick, M W, Walker, R T, Domdey, H, Krupp, G, Gross, H J
Format:	Artigo
Sprache:	Inglês
Veröffentlicht:	Oxford University Press 1981
Online-Zugang:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC326725/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7232209/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.4.965
Tags:	Tag hinzufügen Keine Tags, Fügen Sie das erste Tag hinzu!