The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Olles dieđut

Bibliográfalaš dieđut

Publikašuvnnas:	Nucleic Acids Res
Váldodahkkit:	Takaiwa, F, Kusuda, M, Sugiura, M
Materiálatiipa:	Artigo
Giella:	Inglês
Almmustuhtton:	Oxford University Press 1982
Fáttát:	Research Article
Liŋkkat:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320607/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7201130/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.7.2257
Fáddágilkorat:	Lasit fáddágilkoriid Eai fáddágilkorat, Lasit vuosttaš fáddágilkora!