Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.
The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), d...
محفوظ في:
| الحاوية / القاعدة: | Nucleic Acids Res |
|---|---|
| المؤلفون الرئيسيون: | , |
| التنسيق: | Artigo |
| اللغة: | Inglês |
| منشور في: |
Oxford University Press
1998
|
| الموضوعات: | |
| الوصول للمادة أونلاين: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC147363/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/9461470/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/26.4.1070 |
| الوسوم: |
لا توجد وسوم, كن أول من يضع وسما على هذه التسجيلة!
|