טוען...

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), d...

תיאור מלא

שמור ב:
מידע ביבליוגרפי
Main Authors: Jones, W R, Stone, M P
פורמט: Artigo
שפה:Inglês
יצא לאור: 1998
נושאים:
גישה מקוונת:https://ncbi.nlm.nih.gov/pmc/articles/PMC147363/
https://ncbi.nlm.nih.gov/pubmed/9461470
תגים: הוספת תג
אין תגיות, היה/י הראשונ/ה לתייג את הרשומה!