Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), d...

Volledige beschrijving

Bibliografische gegevens

Gepubliceerd in:	Nucleic Acids Res
Hoofdauteurs:	Jones, W R, Stone, M P
Formaat:	Artigo
Taal:	Inglês
Gepubliceerd in:	Oxford University Press 1998
Onderwerpen:	Research Article
Online toegang:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC147363/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/9461470/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/26.4.1070
Tags:	Voeg label toe Geen labels, Wees de eerste die dit record labelt!