Llwytho...
Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.
The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), d...
Wedi'i Gadw mewn:
| Prif Awduron: | , |
|---|---|
| Fformat: | Artigo |
| Iaith: | Inglês |
| Cyhoeddwyd: |
1998
|
| Pynciau: | |
| Mynediad Ar-lein: | https://ncbi.nlm.nih.gov/pmc/articles/PMC147363/ https://ncbi.nlm.nih.gov/pubmed/9461470 |
| Tagiau: |
Ychwanegu Tag
Dim Tagiau, Byddwch y cyntaf i dagio'r cofnod hwn!
|