A carregar...
Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.
The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), d...
Na minha lista:
| Main Authors: | , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
1998
|
| Assuntos: | |
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC147363/ https://ncbi.nlm.nih.gov/pubmed/9461470 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|