Llwytho...

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), d...

Disgrifiad llawn

Wedi'i Gadw mewn:
Manylion Llyfryddiaeth
Prif Awduron: Jones, W R, Stone, M P
Fformat: Artigo
Iaith:Inglês
Cyhoeddwyd: 1998
Pynciau:
Mynediad Ar-lein:https://ncbi.nlm.nih.gov/pmc/articles/PMC147363/
https://ncbi.nlm.nih.gov/pubmed/9461470
Tagiau: Ychwanegu Tag
Dim Tagiau, Byddwch y cyntaf i dagio'r cofnod hwn!