Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), d...

Täydet tiedot

Bibliografiset tiedot

Julkaisussa:	Nucleic Acids Res
Päätekijät:	Jones, W R, Stone, M P
Aineistotyyppi:	Artigo
Kieli:	Inglês
Julkaistu:	Oxford University Press 1998
Aiheet:	Research Article
Linkit:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC147363/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/9461470/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/26.4.1070
Tagit:	Lisää tagi Ei tageja, Lisää ensimmäinen tagi!