A carregar...
Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation
G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy....
Na minha lista:
| Publicado no: | Sci Rep |
|---|---|
| Main Authors: | , , , , , |
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
Nature Publishing Group UK
2019
|
| Assuntos: | |
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC6408435/ https://ncbi.nlm.nih.gov/pubmed/30850693 https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1038/s41598-019-39941-5 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|