A carregar...

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation

G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy....

ver descrição completa

Na minha lista:
Detalhes bibliográficos
Publicado no:Sci Rep
Main Authors: Cui, Xiaojie, Chen, Han, Zhang, Qiang, Xu, Ming, Yuan, Gu, Zhou, Jiang
Formato: Artigo
Idioma:Inglês
Publicado em: Nature Publishing Group UK 2019
Assuntos:
Acesso em linha:https://ncbi.nlm.nih.gov/pmc/articles/PMC6408435/
https://ncbi.nlm.nih.gov/pubmed/30850693
https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1038/s41598-019-39941-5
Tags: Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!