تحميل...

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation

G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy....

وصف كامل

محفوظ في:
التفاصيل البيبلوغرافية
الحاوية / القاعدة:Sci Rep
المؤلفون الرئيسيون: Cui, Xiaojie, Chen, Han, Zhang, Qiang, Xu, Ming, Yuan, Gu, Zhou, Jiang
التنسيق: Artigo
اللغة:Inglês
منشور في: Nature Publishing Group UK 2019
الموضوعات:
الوصول للمادة أونلاين:https://ncbi.nlm.nih.gov/pmc/articles/PMC6408435/
https://ncbi.nlm.nih.gov/pubmed/30850693
https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1038/s41598-019-39941-5
الوسوم: إضافة وسم
لا توجد وسوم, كن أول من يضع وسما على هذه التسجيلة!