Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation

G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy....

Full description

Saved in:
Bibliographic Details
Published in:Sci Rep
Main Authors: Cui, Xiaojie, Chen, Han, Zhang, Qiang, Xu, Ming, Yuan, Gu, Zhou, Jiang
Format: Artigo
Language:Inglês
Published: Nature Publishing Group UK 2019
Subjects:
Article
Online Access:https://ncbi.nlm.nih.gov/pmc/articles/PMC6408435/
https://ncbi.nlm.nih.gov/pubmed/30850693
https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1038/s41598-019-39941-5
Tags: Add Tag
No Tags, Be the first to tag this record!

Similar Items