Carregant...
Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.
We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT,...
Guardat en:
| Autors principals: | , , |
|---|---|
| Format: | Artigo |
| Idioma: | Inglês |
| Publicat: |
1990
|
| Matèries: | |
| Accés en línia: | https://ncbi.nlm.nih.gov/pmc/articles/PMC362277/ https://ncbi.nlm.nih.gov/pubmed/1690849 |
| Etiquetes: |
Afegir etiqueta
Sense etiquetes, Sigues el primer a etiquetar aquest registre!
|