Carregant...

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT,...

Descripció completa

Guardat en:
Dades bibliogràfiques
Autors principals: Wuerffel, R A, Nathan, A T, Kenter, A L
Format: Artigo
Idioma:Inglês
Publicat: 1990
Matèries:
Accés en línia:https://ncbi.nlm.nih.gov/pmc/articles/PMC362277/
https://ncbi.nlm.nih.gov/pubmed/1690849
Etiquetes: Afegir etiqueta
Sense etiquetes, Sigues el primer a etiquetar aquest registre!