A carregar...

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT,...

ver descrição completa

Na minha lista:
Detalhes bibliográficos
Main Authors: Wuerffel, R A, Nathan, A T, Kenter, A L
Formato: Artigo
Idioma:Inglês
Publicado em: 1990
Assuntos:
Acesso em linha:https://ncbi.nlm.nih.gov/pmc/articles/PMC362277/
https://ncbi.nlm.nih.gov/pubmed/1690849
Tags: Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!