A carregar...
Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.
We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT,...
Na minha lista:
| Main Authors: | , , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
1990
|
| Assuntos: | |
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC362277/ https://ncbi.nlm.nih.gov/pubmed/1690849 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|