Loading...
Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.
We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT,...
Na minha lista:
| Main Authors: | , , |
|---|---|
| Format: | Artigo |
| Sprog: | Inglês |
| Udgivet: |
1990
|
| Fag: | |
| Online adgang: | https://ncbi.nlm.nih.gov/pmc/articles/PMC362277/ https://ncbi.nlm.nih.gov/pubmed/1690849 |
| Tags: |
Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!
|