Loading...

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT,...

Fuld beskrivelse

Na minha lista:
Bibliografiske detaljer
Main Authors: Wuerffel, R A, Nathan, A T, Kenter, A L
Format: Artigo
Sprog:Inglês
Udgivet: 1990
Fag:
Online adgang:https://ncbi.nlm.nih.gov/pmc/articles/PMC362277/
https://ncbi.nlm.nih.gov/pubmed/1690849
Tags: Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!