Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.
A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is...
Guardat en:
| Publicat a: | J Virol |
|---|---|
| Autors principals: | , , , , , |
| Format: | Artigo |
| Idioma: | Inglês |
| Publicat: |
American Society for Microbiology (ASM)
1985
|
| Matèries: | |
| Accés en línia: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC254841/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/2985828/ https://ncbi.nlm.nih.govhttps://doi.org/10.1128/jvi.54.2.639-642.1985 |
| Etiquetes: |
Sense etiquetes, Sigues el primer a etiquetar aquest registre!
|