Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is...

Бүрэн тодорхойлолт

Номзүйн дэлгэрэнгүй

-д хэвлэсэн:	J Virol
Үндсэн зохиолчид:	Casey, T A, Ruyechan, W T, Flora, M N, Reinhold, W, Straus, S E, Hay, J
Формат:	Artigo
Хэл сонгох:	Inglês
Хэвлэсэн:	American Society for Microbiology (ASM) 1985
Нөхцлүүд:	Research Article
Онлайн хандалт:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC254841/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/2985828/ https://ncbi.nlm.nih.govhttps://doi.org/10.1128/jvi.54.2.639-642.1985
Шошгууд:	Шошго нэмэх Шошго байхгүй, Энэхүү баримтыг шошголох эхний хүн болох!