Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.
A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is...
Spremljeno u:
| Izdano u: | J Virol |
|---|---|
| Glavni autori: | , , , , , |
| Format: | Artigo |
| Jezik: | Inglês |
| Izdano: |
American Society for Microbiology (ASM)
1985
|
| Teme: | |
| Online pristup: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC254841/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/2985828/ https://ncbi.nlm.nih.govhttps://doi.org/10.1128/jvi.54.2.639-642.1985 |
| Oznake: |
Bez oznaka, Budi prvi tko označuje ovaj zapis!
|