Caricamento...

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is...

Descrizione completa

Salvato in:
Dettagli Bibliografici
Autori principali: Casey, T A, Ruyechan, W T, Flora, M N, Reinhold, W, Straus, S E, Hay, J
Natura: Artigo
Lingua:Inglês
Pubblicazione: 1985
Soggetti:
Accesso online:https://ncbi.nlm.nih.gov/pmc/articles/PMC254841/
https://ncbi.nlm.nih.gov/pubmed/2985828
Tags: Aggiungi Tag
Nessun Tag, puoi essere il primo ad aggiungerne! !