Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.
A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is...
Сохранить в:
| Опубликовано в:: | J Virol |
|---|---|
| Главные авторы: | , , , , , |
| Формат: | Artigo |
| Язык: | Inglês |
| Опубликовано: |
American Society for Microbiology (ASM)
1985
|
| Предметы: | |
| Online-ссылка: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC254841/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/2985828/ https://ncbi.nlm.nih.govhttps://doi.org/10.1128/jvi.54.2.639-642.1985 |
| Метки: |
Нет меток, Требуется 1-ая метка записи!
|