The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence c...

Fuld beskrivelse

Na minha lista:
Bibliografiske detaljer
Udgivet i:Nucleic Acids Res
Main Authors: Delihas, N, Andersen, J, Andresini, W, Kaufman, L, Lyman, H
Format: Artigo
Sprog:Inglês
Udgivet: Oxford University Press 1981
Fag:
Research Article
Online adgang:https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327627/
https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6798555/
https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.23.6627
Tags: Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!

Lignende værker