Cargando...

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence c...

Descrición completa

Gardado en:
Detalles Bibliográficos
Main Authors: Delihas, N, Andersen, J, Andresini, W, Kaufman, L, Lyman, H
Formato: Artigo
Idioma:Inglês
Publicado: 1981
Assuntos:
Acceso en liña:https://ncbi.nlm.nih.gov/pmc/articles/PMC327627/
https://ncbi.nlm.nih.gov/pubmed/6798555
Tags: Engadir etiqueta
Sen Etiquetas, Sexa o primeiro en etiquetar este rexistro!