The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence c...

Ful tanımlama

Kaydedildi:
Detaylı Bibliyografya
Asıl Yazarlar: Delihas, N, Andersen, J, Andresini, W, Kaufman, L, Lyman, H
Materyal Türü: Artigo
Dil:Inglês
Baskı/Yayın Bilgisi: 1981
Konular:
Research Article
Online Erişim:https://ncbi.nlm.nih.gov/pmc/articles/PMC327627/
https://ncbi.nlm.nih.gov/pubmed/6798555
Etiketler: Etiketle
Etiket eklenmemiş, İlk siz ekleyin!

Benzer Materyaller