The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence c...

Πλήρης περιγραφή

Αποθηκεύτηκε σε:
Λεπτομέρειες βιβλιογραφικής εγγραφής
Κύριοι συγγραφείς: Delihas, N, Andersen, J, Andresini, W, Kaufman, L, Lyman, H
Μορφή: Artigo
Γλώσσα:Inglês
Έκδοση: 1981
Θέματα:
Research Article
Διαθέσιμο Online:https://ncbi.nlm.nih.gov/pmc/articles/PMC327627/
https://ncbi.nlm.nih.gov/pubmed/6798555
Ετικέτες: Προσθήκη ετικέτας
Δεν υπάρχουν, Καταχωρήστε ετικέτα πρώτοι!

Παρόμοια τεκμήρια