The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence c...

Full description

Saved in:
Bibliographic Details
Main Authors: Delihas, N, Andersen, J, Andresini, W, Kaufman, L, Lyman, H
Format: Artigo
Language:Inglês
Published: 1981
Subjects:
Research Article
Online Access:https://ncbi.nlm.nih.gov/pmc/articles/PMC327627/
https://ncbi.nlm.nih.gov/pubmed/6798555
Tags: Add Tag
No Tags, Be the first to tag this record!

Similar Items