Wordt geladen...
The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.
The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence c...
Bewaard in:
| Gepubliceerd in: | Nucleic Acids Res |
|---|---|
| Hoofdauteurs: | , , , , |
| Formaat: | Artigo |
| Taal: | Inglês |
| Gepubliceerd in: |
Oxford University Press
1981
|
| Onderwerpen: | |
| Online toegang: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327627/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6798555/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.23.6627 |
| Tags: |
Voeg label toe
Geen labels, Wees de eerste die dit record labelt!
|