Wordt geladen...

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence c...

Volledige beschrijving

Bewaard in:
Bibliografische gegevens
Gepubliceerd in:Nucleic Acids Res
Hoofdauteurs: Delihas, N, Andersen, J, Andresini, W, Kaufman, L, Lyman, H
Formaat: Artigo
Taal:Inglês
Gepubliceerd in: Oxford University Press 1981
Onderwerpen:
Online toegang:https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327627/
https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6798555/
https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.23.6627
Tags: Voeg label toe
Geen labels, Wees de eerste die dit record labelt!