Llwytho...
The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8
Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...
Wedi'i Gadw mewn:
| Prif Awduron: | , , , , |
|---|---|
| Fformat: | Artigo |
| Iaith: | Inglês |
| Cyhoeddwyd: |
1981
|
| Pynciau: | |
| Mynediad Ar-lein: | https://ncbi.nlm.nih.gov/pmc/articles/PMC327506/ https://ncbi.nlm.nih.gov/pubmed/6171775 |
| Tagiau: |
Ychwanegu Tag
Dim Tagiau, Byddwch y cyntaf i dagio'r cofnod hwn!
|