The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...

Full description

Bibliographic Details

Published in:	Nucleic Acids Res
Main Authors:	Kumagai, Izumi, Digweed, Martin, Erdmann, Volker A., Watanabe, Kimitsuna, Oshima, Tairo
Format:	Artigo
Language:	Inglês
Published:	Oxford University Press 1981
Subjects:	Molecular Biology
Online Access:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327506/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6171775/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.19.5159
Tags:	Add Tag No Tags, Be the first to tag this record!