The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...

Disgrifiad llawn

Wedi'i Gadw mewn:
Manylion Llyfryddiaeth
Prif Awduron: Kumagai, Izumi, Digweed, Martin, Erdmann, Volker A., Watanabe, Kimitsuna, Oshima, Tairo
Fformat: Artigo
Iaith:Inglês
Cyhoeddwyd: 1981
Pynciau:
Molecular Biology
Mynediad Ar-lein:https://ncbi.nlm.nih.gov/pmc/articles/PMC327506/
https://ncbi.nlm.nih.gov/pubmed/6171775
Tagiau: Ychwanegu Tag
Dim Tagiau, Byddwch y cyntaf i dagio'r cofnod hwn!

Eitemau Tebyg