The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...

Fuld beskrivelse

Na minha lista:
Bibliografiske detaljer
Main Authors: Kumagai, Izumi, Digweed, Martin, Erdmann, Volker A., Watanabe, Kimitsuna, Oshima, Tairo
Format: Artigo
Sprog:Inglês
Udgivet: 1981
Fag:
Molecular Biology
Online adgang:https://ncbi.nlm.nih.gov/pmc/articles/PMC327506/
https://ncbi.nlm.nih.gov/pubmed/6171775
Tags: Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!

Lignende værker