Načítá se...
The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8
Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...
Uloženo v:
| Vydáno v: | Nucleic Acids Res |
|---|---|
| Hlavní autoři: | , , , , |
| Médium: | Artigo |
| Jazyk: | Inglês |
| Vydáno: |
Oxford University Press
1981
|
| Témata: | |
| On-line přístup: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327506/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6171775/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.19.5159 |
| Tagy: |
Přidat tag
Žádné tagy, Buďte první, kdo otaguje tento záznam!
|