The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Veröffentlicht in:Nucleic Acids Res
Hauptverfasser: Kumagai, Izumi, Digweed, Martin, Erdmann, Volker A., Watanabe, Kimitsuna, Oshima, Tairo
Format: Artigo
Sprache:Inglês
Veröffentlicht: Oxford University Press 1981
Schlagworte:
Molecular Biology
Online Zugang:https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327506/
https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6171775/
https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.19.5159
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!

Ähnliche Einträge