Wird geladen...
The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8
Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...
Gespeichert in:
| Veröffentlicht in: | Nucleic Acids Res |
|---|---|
| Hauptverfasser: | , , , , |
| Format: | Artigo |
| Sprache: | Inglês |
| Veröffentlicht: |
Oxford University Press
1981
|
| Schlagworte: | |
| Online Zugang: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327506/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6171775/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.19.5159 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|