The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...

Descripción completa

Guardado en:
Detalles Bibliográficos
Autores principales: Kumagai, Izumi, Digweed, Martin, Erdmann, Volker A., Watanabe, Kimitsuna, Oshima, Tairo
Formato: Artigo
Lenguaje:Inglês
Publicado: 1981
Materias:
Molecular Biology
Acceso en línea:https://ncbi.nlm.nih.gov/pmc/articles/PMC327506/
https://ncbi.nlm.nih.gov/pubmed/6171775
Etiquetas: Agregar Etiqueta
Sin Etiquetas, Sea el primero en etiquetar este registro!

Ejemplares similares