Načítá se...

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...

Celý popis

Uloženo v:
Podrobná bibliografie
Vydáno v:Nucleic Acids Res
Hlavní autoři: Kumagai, Izumi, Digweed, Martin, Erdmann, Volker A., Watanabe, Kimitsuna, Oshima, Tairo
Médium: Artigo
Jazyk:Inglês
Vydáno: Oxford University Press 1981
Témata:
On-line přístup:https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327506/
https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6171775/
https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.19.5159
Tagy: Přidat tag
Žádné tagy, Buďte první, kdo otaguje tento záznam!