تحميل...
The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8
Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...
محفوظ في:
| المؤلفون الرئيسيون: | , , , , |
|---|---|
| التنسيق: | Artigo |
| اللغة: | Inglês |
| منشور في: |
1981
|
| الموضوعات: | |
| الوصول للمادة أونلاين: | https://ncbi.nlm.nih.gov/pmc/articles/PMC327506/ https://ncbi.nlm.nih.gov/pubmed/6171775 |
| الوسوم: |
إضافة وسم
لا توجد وسوم, كن أول من يضع وسما على هذه التسجيلة!
|