The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...

Deskribapen osoa

Xehetasun bibliografikoak

Argitaratua izan da:	Nucleic Acids Res
Egile Nagusiak:	Kumagai, Izumi, Digweed, Martin, Erdmann, Volker A., Watanabe, Kimitsuna, Oshima, Tairo
Formatua:	Artigo
Hizkuntza:	Inglês
Argitaratua:	Oxford University Press 1981
Gaiak:	Molecular Biology
Sarrera elektronikoa:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327506/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6171775/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.19.5159
Etiketak:	Etiketa erantsi Etiketarik gabe, Izan zaitez lehena erregistro honi etiketa jartzen!