تحميل...

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most sim...

وصف كامل

محفوظ في:
التفاصيل البيبلوغرافية
المؤلفون الرئيسيون: Kumagai, Izumi, Digweed, Martin, Erdmann, Volker A., Watanabe, Kimitsuna, Oshima, Tairo
التنسيق: Artigo
اللغة:Inglês
منشور في: 1981
الموضوعات:
الوصول للمادة أونلاين:https://ncbi.nlm.nih.gov/pmc/articles/PMC327506/
https://ncbi.nlm.nih.gov/pubmed/6171775
الوسوم: إضافة وسم
لا توجد وسوم, كن أول من يضع وسما على هذه التسجيلة!