Wird geladen...
Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K(+)-induced conformational transition from an initial hairpin structure to the final G4(...
Gespeichert in:
| Veröffentlicht in: | Nucleic Acids Res |
|---|---|
| Hauptverfasser: | , , , , , |
| Format: | Artigo |
| Sprache: | Inglês |
| Veröffentlicht: |
Oxford University Press
2020
|
| Schlagworte: | |
| Online Zugang: | https://ncbi.nlm.nih.gov/pmc/articles/PMC7026657/ https://ncbi.nlm.nih.gov/pubmed/31912153 https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1093/nar/gkz1207 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|