Wird geladen...

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K(+)-induced conformational transition from an initial hairpin structure to the final G4(...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Veröffentlicht in:Nucleic Acids Res
Hauptverfasser: Wang, Zi-Fu, Li, Ming-Hao, Chu, I-Te, Winnerdy, Fernaldo R, Phan, Anh T, Chang, Ta-Chau
Format: Artigo
Sprache:Inglês
Veröffentlicht: Oxford University Press 2020
Schlagworte:
Online Zugang:https://ncbi.nlm.nih.gov/pmc/articles/PMC7026657/
https://ncbi.nlm.nih.gov/pubmed/31912153
https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1093/nar/gkz1207
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!