A carregar...

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K(+)-induced conformational transition from an initial hairpin structure to the final G4(...

ver descrição completa

Na minha lista:
Detalhes bibliográficos
Publicado no:Nucleic Acids Res
Main Authors: Wang, Zi-Fu, Li, Ming-Hao, Chu, I-Te, Winnerdy, Fernaldo R, Phan, Anh T, Chang, Ta-Chau
Formato: Artigo
Idioma:Inglês
Publicado em: Oxford University Press 2020
Assuntos:
Acesso em linha:https://ncbi.nlm.nih.gov/pmc/articles/PMC7026657/
https://ncbi.nlm.nih.gov/pubmed/31912153
https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1093/nar/gkz1207
Tags: Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!