Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K(+)-induced conformational transition from an initial hairpin structure to the final G4(...

Volledige beschrijving

Bewaard in:
Bibliografische gegevens
Gepubliceerd in:Nucleic Acids Res
Hoofdauteurs: Wang, Zi-Fu, Li, Ming-Hao, Chu, I-Te, Winnerdy, Fernaldo R, Phan, Anh T, Chang, Ta-Chau
Formaat: Artigo
Taal:Inglês
Gepubliceerd in: Oxford University Press 2020
Onderwerpen:
Chemical Biology and Nucleic Acid Chemistry
Online toegang:https://ncbi.nlm.nih.gov/pmc/articles/PMC7026657/
https://ncbi.nlm.nih.gov/pubmed/31912153
https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1093/nar/gkz1207
Tags: Voeg label toe
Geen labels, Wees de eerste die dit record labelt!

Gelijkaardige items