Llwytho...
Site-resolved stabilization of a DNA triple helix by magnesium ions
Proton exchange and NMR spectroscopy have been used to define the effects of Mg(2+) ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and...
Wedi'i Gadw mewn:
| Prif Awduron: | , |
|---|---|
| Fformat: | Artigo |
| Iaith: | Inglês |
| Cyhoeddwyd: |
Oxford University Press
2004
|
| Pynciau: | |
| Mynediad Ar-lein: | https://ncbi.nlm.nih.gov/pmc/articles/PMC373380/ https://ncbi.nlm.nih.gov/pubmed/14769945 https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1093/nar/gkh228 |
| Tagiau: |
Ychwanegu Tag
Dim Tagiau, Byddwch y cyntaf i dagio'r cofnod hwn!
|