Wordt geladen...

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg(2+) ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and...

Volledige beschrijving

Bewaard in:
Bibliografische gegevens
Hoofdauteurs: Coman, Daniel, Russu, Irina M.
Formaat: Artigo
Taal:Inglês
Gepubliceerd in: Oxford University Press 2004
Onderwerpen:
Online toegang:https://ncbi.nlm.nih.gov/pmc/articles/PMC373380/
https://ncbi.nlm.nih.gov/pubmed/14769945
https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1093/nar/gkh228
Tags: Voeg label toe
Geen labels, Wees de eerste die dit record labelt!