A carregar...

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg(2+) ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and...

ver descrição completa

Na minha lista:
Detalhes bibliográficos
Main Authors: Coman, Daniel, Russu, Irina M.
Formato: Artigo
Idioma:Inglês
Publicado em: Oxford University Press 2004
Assuntos:
Acesso em linha:https://ncbi.nlm.nih.gov/pmc/articles/PMC373380/
https://ncbi.nlm.nih.gov/pubmed/14769945
https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1093/nar/gkh228
Tags: Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!