The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.
Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this...
Gardado en:
| Publicado en: | Nucleic Acids Res |
|---|---|
| Principais autores: | , |
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado: |
Oxford University Press
1980
|
| Acceso en liña: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324120/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7001357/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.12.2783 |
| Tags: |
Sen Etiquetas, Sexa o primeiro en etiquetar este rexistro!
|