A carregar...

The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this...

ver descrição completa

Na minha lista:
Detalhes bibliográficos
Main Authors: Kilpatrick, M W, Walker, R T
Formato: Artigo
Idioma:Inglês
Publicado em: 1980
Acesso em linha:https://ncbi.nlm.nih.gov/pmc/articles/PMC324120/
https://ncbi.nlm.nih.gov/pubmed/7001357
Tags: Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!