Đang tải...

The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this...

Mô tả đầy đủ

Đã lưu trong:
Chi tiết về thư mục
Những tác giả chính: Kilpatrick, M W, Walker, R T
Định dạng: Artigo
Ngôn ngữ:Inglês
Được phát hành: 1980
Truy cập trực tuyến:https://ncbi.nlm.nih.gov/pmc/articles/PMC324120/
https://ncbi.nlm.nih.gov/pubmed/7001357
Các nhãn: Thêm thẻ
Không có thẻ, Là người đầu tiên thẻ bản ghi này!