A carregar...
The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.
Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this...
Na minha lista:
| Main Authors: | , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
1980
|
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC324120/ https://ncbi.nlm.nih.gov/pubmed/7001357 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|