Đang tải...
The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.
Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this...
Đã lưu trong:
| Những tác giả chính: | , |
|---|---|
| Định dạng: | Artigo |
| Ngôn ngữ: | Inglês |
| Được phát hành: |
1980
|
| Truy cập trực tuyến: | https://ncbi.nlm.nih.gov/pmc/articles/PMC324120/ https://ncbi.nlm.nih.gov/pubmed/7001357 |
| Các nhãn: |
Thêm thẻ
Không có thẻ, Là người đầu tiên thẻ bản ghi này!
|