Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.
The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (...
Guardat en:
| Publicat a: | Nucleic Acids Res |
|---|---|
| Autors principals: | , |
| Format: | Artigo |
| Idioma: | Inglês |
| Publicat: |
Oxford University Press
1982
|
| Matèries: | |
| Accés en línia: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320554/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6280154/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.5.1625 |
| Etiquetes: |
Sense etiquetes, Sigues el primer a etiquetar aquest registre!
|