Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.
The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (...
Sábháilte in:
| Foilsithe in: | Nucleic Acids Res |
|---|---|
| Príomhchruthaitheoirí: | , |
| Formáid: | Artigo |
| Teanga: | Inglês |
| Foilsithe / Cruthaithe: |
Oxford University Press
1982
|
| Ábhair: | |
| Rochtain ar líne: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320554/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6280154/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.5.1625 |
| Clibeanna: |
Níl clibeanna ann, Bí ar an gcéad duine le clib a chur leis an taifead seo!
|