Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.
The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (...
Enregistré dans:
| Publié dans: | Nucleic Acids Res |
|---|---|
| Auteurs principaux: | , |
| Format: | Artigo |
| Langue: | Inglês |
| Publié: |
Oxford University Press
1982
|
| Sujets: | |
| Accès en ligne: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320554/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6280154/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.5.1625 |
| Tags: |
Pas de tags, Soyez le premier à ajouter un tag!
|