Cargando...

Putative DNA Quadruplex Formation within the Human c-kit Oncogene

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Vari...

Descrición completa

Gardado en:
Detalles Bibliográficos
Main Authors: Rankin, Sarah, Reszka, Anthony P., Huppert, Julian, Zloh, Mire, Parkinson, Gary N., Todd, Alan K., Ladame, Sylvain, Balasubramanian, Shankar, Neidle, Stephen
Formato: Artigo
Idioma:Inglês
Publicado: 2005
Assuntos:
Acceso en liña:https://ncbi.nlm.nih.gov/pmc/articles/PMC2195896/
https://ncbi.nlm.nih.gov/pubmed/16045346
https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1021/ja050823u
Tags: Engadir etiqueta
Sen Etiquetas, Sexa o primeiro en etiquetar este rexistro!