A carregar...
Putative DNA Quadruplex Formation within the Human c-kit Oncogene
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Vari...
Na minha lista:
| Main Authors: | , , , , , , , , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
2005
|
| Assuntos: | |
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC2195896/ https://ncbi.nlm.nih.gov/pubmed/16045346 https://ncbi.nlm.nih.govhttp://dx.doi.org/10.1021/ja050823u |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|