Φορτώνει......

Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA GUC Asp.

A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of...

Πλήρης περιγραφή

Αποθηκεύτηκε σε:
Λεπτομέρειες βιβλιογραφικής εγγραφής
Κύριοι συγγραφείς: Agrawal, H P, Randerath, K, Randerath, E
Μορφή: Artigo
Γλώσσα:Inglês
Έκδοση: 1981
Διαθέσιμο Online:https://ncbi.nlm.nih.gov/pmc/articles/PMC326869/
https://ncbi.nlm.nih.gov/pubmed/6912441
Ετικέτες: Προσθήκη ετικέτας
Δεν υπάρχουν, Καταχωρήστε ετικέτα πρώτοι!