Φορτώνει......
Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA GUC Asp.
A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of...
Αποθηκεύτηκε σε:
| Κύριοι συγγραφείς: | , , |
|---|---|
| Μορφή: | Artigo |
| Γλώσσα: | Inglês |
| Έκδοση: |
1981
|
| Διαθέσιμο Online: | https://ncbi.nlm.nih.gov/pmc/articles/PMC326869/ https://ncbi.nlm.nih.gov/pubmed/6912441 |
| Ετικέτες: |
Προσθήκη ετικέτας
Δεν υπάρχουν, Καταχωρήστε ετικέτα πρώτοι!
|