A carregar...

Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA GUC Asp.

A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of...

ver descrição completa

Na minha lista:
Detalhes bibliográficos
Main Authors: Agrawal, H P, Randerath, K, Randerath, E
Formato: Artigo
Idioma:Inglês
Publicado em: 1981
Acesso em linha:https://ncbi.nlm.nih.gov/pmc/articles/PMC326869/
https://ncbi.nlm.nih.gov/pubmed/6912441
Tags: Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!