Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGG...

Ful tanımlama

Kaydedildi:
Detaylı Bibliyografya
Asıl Yazarlar: Milman, G, Hwang, E S
Materyal Türü: Artigo
Dil:Inglês
Baskı/Yayın Bilgisi: 1987
Konular:
Research Article
Online Erişim:https://ncbi.nlm.nih.gov/pmc/articles/PMC253970/
https://ncbi.nlm.nih.gov/pubmed/3027376
Etiketler: Etiketle
Etiket eklenmemiş, İlk siz ekleyin!

Benzer Materyaller