Carregando...

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGG...

ver descrição completa

Na minha lista:
Detalhes bibliográficos
Principais autores: Milman, G, Hwang, E S
Formato: Artigo
Idioma:Inglês
Publicado em: 1987
Assuntos:
Acesso em linha:https://ncbi.nlm.nih.gov/pmc/articles/PMC253970/
https://ncbi.nlm.nih.gov/pubmed/3027376
Tags: Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!