Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.
The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sect...
Guardat en:
| Publicat a: | Infect Immun |
|---|---|
| Autors principals: | , , , , , |
| Format: | Artigo |
| Idioma: | Inglês |
| Publicat: |
American Society for Microbiology (ASM)
1994
|
| Matèries: | |
| Accés en línia: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC186156/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7507900/ https://ncbi.nlm.nih.govhttps://doi.org/10.1128/iai.62.2.673-679.1994 |
| Etiquetes: |
Sense etiquetes, Sigues el primer a etiquetar aquest registre!
|