Loading...
Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.
The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. inf...
Na minha lista:
| Main Authors: | , , , , , |
|---|---|
| Format: | Artigo |
| Sprog: | Inglês |
| Udgivet: |
1994
|
| Fag: | |
| Online adgang: | https://ncbi.nlm.nih.gov/pmc/articles/PMC186156/ https://ncbi.nlm.nih.gov/pubmed/7507900 |
| Tags: |
Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!
|