Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.

The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sect...

Descrizione completa

Dettagli Bibliografici

Pubblicato in:	Infect Immun
Autori principali:	Forsgren, J, Samuelson, A, Ahlin, A, Jonasson, J, Rynnel-Dagöö, B, Lindberg, A
Natura:	Artigo
Lingua:	Inglês
Pubblicazione:	American Society for Microbiology (ASM) 1994
Soggetti:	Research Article
Accesso online:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC186156/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7507900/ https://ncbi.nlm.nih.govhttps://doi.org/10.1128/iai.62.2.673-679.1994
Tags:	Aggiungi Tag Nessun Tag, puoi essere il primo ad aggiungerne!!