Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.

The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. inf...

Full beskrivning

Sparad:
Bibliografiska uppgifter
Huvudupphovsmän: Forsgren, J, Samuelson, A, Ahlin, A, Jonasson, J, Rynnel-Dagöö, B, Lindberg, A
Materialtyp: Artigo
Språk:Inglês
Publicerad: 1994
Ämnen:
Research Article
Länkar:https://ncbi.nlm.nih.gov/pmc/articles/PMC186156/
https://ncbi.nlm.nih.gov/pubmed/7507900
Taggar: Lägg till en tagg
Inga taggar, Lägg till första taggen!

Liknande verk