Detection of ammonium-oxidizing bacteria of the beta-subclass of the class Proteobacteria in aquatic samples with the PCR.
Volume 61, no. 4, p. 1445, column 2, line 38: The sequence "5(prm1) AGCTACGTTACCAGCCAAGCC 3(prm1)" should read "5(prm1) AGCTACGTTACCAGCCC 3(prm1)."
שמור ב:
| הוצא לאור ב: | Appl Environ Microbiol |
|---|---|
| Principais autores: | , |
| פורמט: | Artigo |
| שפה: | Inglês |
| יצא לאור: |
American Society for Microbiology (ASM)
1995
|
| נושאים: | |
| גישה מקוונת: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC167558/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7618898/ https://ncbi.nlm.nih.govhttps://doi.org/10.1128/aem.61.7.2811-2811c.1995 |
| תגים: |
אין תגיות, היה/י הראשונ/ה לתייג את הרשומה!
|