A carregar...
Detection of ammonium-oxidizing bacteria of the beta-subclass of the class Proteobacteria in aquatic samples with the PCR.
Volume 61, no. 4, p. 1445, column 2, line 38: The sequence "5(prm1) AGCTACGTTACCAGCCAAGCC 3(prm1)" should read "5(prm1) AGCTACGTTACCAGCCC 3(prm1)."
Na minha lista:
| Main Authors: | , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
1995
|
| Assuntos: | |
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC167558/ https://ncbi.nlm.nih.gov/pubmed/7618898 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|