Loading...
Two thraustochytrid 5S ribosomal RNAs.
The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACAC...
Na minha lista:
| Main Authors: | , |
|---|---|
| Format: | Artigo |
| Sprog: | Inglês |
| Udgivet: |
1982
|
| Online adgang: | https://ncbi.nlm.nih.gov/pmc/articles/PMC327087/ https://ncbi.nlm.nih.gov/pubmed/7162992 |
| Tags: |
Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!
|